ingridscience

DNA and evolution

Summary
Look at different animals, discuss the differences and similarities between us and them, then extract the molecule that makes those differences: DNA.
Curriculum connection (2005 science topic)
Life Science: Animal Growth and Changes (grade 2)
Life Science: Diversity of Life (grade 6)
Physical Science: Chemistry (grade 7)
Materials
  • live animals to look at, if available
  • photos of the animal skeletons
  • materials for DNA activity
Procedure

Look at a collection of live animals (we had two reptiles: a bearded dragon and a snake) and name similarities and differences between us and them, in our bodies features and how we behave.

Bearded dragon discussion: we are both animals, we both breathe air, we both have legs. Note: bearded dragon has a hole for an ear. Show skeleton of lizard and us to show how similar to us they are.
Corn snake discussion: both animals. Snakes hear through jaw bone. No legs. Tongue for smelling. Show snake skeleton pictures.

What makes us all look different from them in some ways and different in others? What makes us look like we do?
DNA.

DNA has units ACGT. With a different order of units the instructions are changed.
Instructions very similar between people, more different between us and a snake, even more different between us and a wood bug [we had just looked at wood bugs too].

Isolate our own DNA, so you can see it.
We won’t be able to see the ACGTs, but can see strands stuck together.

Grades taught
Gr K
Gr 1
Gr 2
Gr 3
Gr 4

Respiratory and Circulatory Systems

Summary
Listen to your heart and feel your pulse. Model a working lung and listen to your own heart beat. Exercise to observe changes in your breathing and heartbeat.
Curriculum connection (2005 science topic)
Life Science: Animal Growth and Changes (grade 2)
Life Science: Plant Growth and Changes (grade 3)
Life Science: Human Body (grade 5)
Life Science: Diversity of Life (grade 6)
Procedure

Show an image of the circulatory and respiratory systems.
e.g. https://www.pinterest.ca/pin/843439836446359943/
The respiratory and circulatory systems bring O2 to cells of your body and takes away CO2 waste.
Respiratory system = lungs, mouth and throat. Brings oxygen into the body, and exhales CO2.
Circulatory system = blood vessels, heart which pumps the blood. Brings O2 to cells, removes CO2.

Show a beating heart gif: https://en.wikipedia.org/wiki/Heart#/media/File:CG_Heart.gif
Point out the valves closing one after the other, the 'lub dub' of the beating heart.
Students use stethoscopes to listen to the valves closing in their hearts.
I do not have one stethoscope per student, so they pair up, and one listens to their heart (in the silent classroom), while the other runs around the school/field once (makes the beats stronger and louder, so easier to hear). Switch after 2 mins. Switch a couple of times.
Your heart beats your whole life, pushing blood around your body to bring oxygen to every cell.
Your heart is a piece of muscle (meat). Optionally show images of cow heart.

Students feel their pulse, which is the push of blood in blood vessels with each heartbeat.
Use two flat fingers to feel for it.
Radial pulse - on the wrist just below the thumb (pulse in the radial artery).
Carotid pulse - on the side of the neck under the jaw bone. (One of the strongest pulses as it is close to the heart. The carotid artery supplies blood to the brain.

Calculate how many times your heart beats in your lifetime. Count 15 seconds.
(mine: 64 beats/minute = 30 thousand/year (more when I exercise) = 3 billion (^9) in a lifetime to 90).
This is an underestimate as it beats faster when you exercise.

The lungs bring oxygen into your body, and exhale carbon dioxide.
Lung model to show how air is drawn into the lungs as the diaphragm muscle contracts.

Breathing and heart rate before/after exercise activity:
Standing up, quiet in class, close eyes - listen to your own breathing. Feel your heartbeat if you can.
Exercise hard for 30 seconds (start clock when every student has started up). Go hard running on the spot.
Count down to standing still again. Close eyes.
What do you notice about changes in your breathing and heart? (see students' list in photo)
Breathing is deeper and faster. Might also notice your heart beating harder and faster.
When you exercise, your breathing rate and depth increases, and your heart beat gets stronger and speeds up. It is all automatic (you don’t think about it to make it happen).
When you work hard, your cells work hard - they use up more oxygen and release more CO2.
Your brainstem detects the increased CO2 in your blood, and signals your heart rate to increase and your breathing to become deeper.

Optional: activity to show what happens to the blood when CO2 increases: carbon dioxide acidifies water [blood] - the brainstem measures the acidity of the blood and so can sense when CO2 in the blood rises.

Deeper breathing means extra oxygen is brought into the body and taken up by the blood. And also more CO2 is exhaled from the body.
Harder and faster heart beats mean more blood is brought to the lungs, to pick up more oxygen, and get it to the cells. And more CO2 is removed.
Refer to the respiratory and circulatory system diagram, working as a system of parts (heart, lungs and blood vessels).

(You can use the cortex of your brain to override and slow down breathing by thinking about it.)

Find your blood
Now that you have looked at models of blood, let's look at the real thing that transports oxygen from your lungs to all fo your cells.
Find places that you can see your own blood.
Distribute flashlight to students, so that they can shine it through their skin and find the red of blood.
[Wrist, under tongue, eyeballs the blood is easily visible. Flashlight through closed fingers.]

Grades taught
Gr 4
Gr 5
Gr 6

Balanced/unbalanced Forces

Summary
Experiment with things that balance, and discuss the forces involved when they are balanced and unbalanced.
Procedure

Do a selection of the activities.

Start or end with Balancing your body challenges.

Finding the balance point of a stick or ruler can be done:
1. large scale, using long dowel rods, with fewer students, or with student groups. Large balls of homemade play dough are added to each side of a long stick and it is balanced on a finger, to explore how the balance point moves as the mass is redistributed.
2. small scale, using a (paint) stick or ruler and modelling clay/lego. The ruler can be used for quantitative measurement and graphing.

Make a mobile, using the principles learned above to quickly assess where the balance point of each stick in the mobile is.

Experiment with the centre of mass with a balancing sculpture.
Discuss that without the weights the toothpick is unstable and falls because the mass is above the balance point (the tip of the toothpick on your finger). The sculpture moves til the mass (or the average of the distributed mass; centre of mass/gravity) is low as possible and below the balance point. Adding weight below the balance point lowers the centre of mass and makes it more stable.

A rocket has balanced and unbalanced forces alternating before, during and after launch.
At rest before and after launch, the force of gravity on the rocket balances the force of the Earth pushing back up on it, so it does not move.
When launched, the force of the propellant pushing the rocket up is greater than the force of gravity pulling down (they are unbalanced), so the rocket moves upwards.
At the top of its trajectory, the force from the propellant is running out and is balanced by the force of gravity, so the rocket is stopped for a moment.
Then as the rocket falls, there is no upwards force, so the forces are unbalanced again, with the force of gravity winning over.

Grades taught
Gr K
Gr 1
Gr 2
Gr 3
Gr 4
Gr 5
Gr 7

Kingdoms of Life

Summary
Students collect samples from each of the kingdoms of life, then view them under microscopes.
Curriculum connection (2005 science topic)
Life Science: Diversity of Life (grade 6)
Procedure

Hunt for specimens from each of the Kingdoms of Life, then use magnifiers and microscopes to view them closely.

Notes on each Kingdom and how to magnify:
Animals are best viewed under dissecting microscopes, to see body parts within the whole animal. You can also look at cheek cells under the transmission microscope, to see . Daphnia can be put under the transmission microscope, but too large and moving too much.
Plants under either microscope. Tear a leaf to make an edge with a thin layer, to see individual cells.
Fungi - best under dissecting microscope, to see individual filaments.
Protists - transmission microscope. Separate out a few pond algae filaments, to view the line of cells (with nuclei and chloroplasts). Also single celled protists swimming among the algae filaments (if the algae has not dried out).
Monera - hard to find in soil because of all the dirt particles, but look for moving dots under 100X and 400X. Also find bacteria in a scoop of yogurt - look at it right away before it dries up under the hot microscope lamp.

Grades taught
Gr 5
Gr 6
Gr 7

Balance point on a stick or ruler / See saw

Summary
Balance a stick or ruler on your finger or on a pencil. Experiment with adding mass to one or both sides of the stick or ruler, to see how it changes the balance point.
Materials
  • ruler or paint stick for desktop activity
  • long wooden stick, up to 1/2" diameter for activity that needs standing space
  • play dough
  • optional: other classroom objects to balance e.g. lego or small plastic toys
Procedure

Using a paint stick (good for lower primaries)
The fulcrum can be a pencil or short dowel. Find the balance point for different sized balls of play dough on each end. Younger students can add in lego or other classroom objects. Give a set of challenges (see photo) and/or Encourage investigation with questions: How does moving the fulcrum change how they balance? Can a small ball lift a large ball? How small can a small ball be to do this? Where does the fulcrum have to be to make them balance each other?
Discuss the pushes and pulls that keep it balanced: gravity pulls on the weights, to make them push down on the stick. When the pushes on each side of the balance point are equal, the stick will balance.

Using a ruler, and adding measuring
The same activity as with the paint stick can be conducted with a ruler, and the markings used to record how far a mass is from the centre and how this affects the balance point. Graph the results and the points should make a straight line (though data will be more messy than this). To graph the data from multiple students on one graph, make sure they have the same sized play dough.

More free exploration
Students can also use paint sticks and be given additional materials to try lever free experimentation, for some less structured exploration of levers and balancing, probably best done after these more structured activities, to ensure some focus.

Using a long stick
More dramatic, but more chaotic with many long sticks in use.

Balance the stick on one finger.
The balance point should be half way along.
This is because the mass of the stick is the same on each side, so gravity pulls down on each side with equal force. As the stick is an even width, the balance point will be in the centre.

A trick to find the balance point of any stick:
Start with the stick resting on a finger at each end, then slowly slide the fingers together along the underside of the stick. The rod will slide over the fingers, then stop moving over them, in turn, as the weight on each finger changes. The fingers will end up meeting at the balance point in the middle of the stick. See http://www.exploratorium.edu/snacks/center-gravity

Now add some play dough to one end of the stick, and find the new balance point.
It should be nearer the weight.

Now experiment with adding different sizes of play dough to different places along the stick.
The balance point will move depending on the relative weights and their positions out on the stick.
The lighter weights need a longer length of stick to balance a heavier weight. The further out the mass is, the greater force it exerts (actually torque as the force is exerted on a rotating lever arm). The mass has more of an effect when it is further away (the torque is greater).
Students can draw what they find in each case (see photo and attached worksheet).

Notes

A ridged pencil can make it tricky to balance a ruler - add a small piece of play dough under the pencil to hold it still - maybe in combination with a smooth, round pencil?

Using a ruler allows students to easily read off and take note of the position of their fulcrum. Adding a gram scale to weigh lumps of play dough would allow for some great data collection comparing balance points for varying lever lengths and load weights.

Construct a balancing stick with defined positions that weights can be added to see the effect of position and mass on the balance of the stick: https://www.youtube.com/watch?v=MAINjKTu1As

Balancing and torque: http://www.discovery.com/tv-shows/mythbusters/about-this-show/physics-o…

Grades taught
Gr K
Gr 1
Gr 2
Gr 3
Gr 4
Gr 5

Kingdoms of Life hunt

Summary
Students hunt for living things from all the kingdoms of life, and make a collection with a sample from each kingdom.
Science topic (2005 curriculum connection)
Life Science: Diversity of Life (grade 6)
Materials
  • small paint trays, ice cube trays, or other collecting dishes with compartments
  • optional: droppers (to move small amounts of water and pick up small aquatic living things
  • optional: fine net to catch small aquatic living things
  • optional: tree of life (evolutionary tree) poster e.g. this one
Procedure

Students are taken to an outside location with a variety of ecosystems e.g. small pond, rotting wood area (see image of rotting wood with animals and fungi on it).
Lay out nets, droppers, and collecting buckets in a central area.
Review the kingdoms of life and the living things that are in each - use an evolutionary tree poster if you have one.
Give each student a tray with compartments. Ask them to find examples of each kingdom and put them in each well of the tray.

Examples that they might find:
Animals - pond organisms, insects, worms, wood bugs, snails.
Plants - any leaf, moss, pond plants such as duck weed.
Fungi - white filaments on rotting log, mushrooms. Fungi have a distinctive smell.
Protists - pond algae, pond single celled organisms recovered with algae e.g. Paramecium.
Eubacteria - in dirt, our bodies
Archaea - in the soil, as well as other more extreme environments that are hot, salty or acidic
(Note Monera is an old kingdom, that has now been split into Eubacteria and Archaea.)

The tray in the image contains:
Daphnia from the pond (animal)
Clover leaf (plant)
Rotting wood (contains fungi)
Pond algae (protist)
Soil (eubacteria and archaea)

Notes

Bayview (while up at QE portables) did this activity in the forest and Camouson Bog (acidic environment).

Grades taught
Gr 5
Gr 6

DNA code puzzle

Summary
Use a two-letter code to create an image, and compare with images made from the same two letters in a different sequence. Use to explain how different DNA sequences give rise to different living things.
Science topic (2005 curriculum connection)
Life Science: Characteristics of Living Things (grade K)
Life Science: Animal Growth and Changes (grade 2)
Life Science: Plant Growth and Changes (grade 3)
Life Science: Human Body (grade 5)
Life Science: Diversity of Life (grade 6)
Physical Science: Properties of Objects and Materials (grade K)
Physical Science: Chemistry (grade 7)
Materials
  • copies of the attached codes, one code per student
  • pencil for each student, soft enough to shade in a box on the grid
Procedure

Distribute the code worksheets (each code half a sheet in the attachment) and pencils. Make sure that students sitting near to each other do not have the same code.

Explain how to fill in the code sheets:
Find the lines of code at the bottom of your sheet, made up of Ws and Ps. You will use these to fill in the boxes of the grid. If you read a P you will fill in the square with pencil; if you read a W you will leave the square white.
So for example, looking at Code B, the first letter in the first block of code is W, so leave the top left box of the grid white. The next code letter is P, so shade in the next square in that row with pencil. The following square will be shaded with pencil, and the one after that will be white. And so on. It is helpful to cross out the code letters one by one as the boxes are filled in.
Once the first block of code is all crossed out, the first row of boxes should be completed. The next block of code corresponds to the next row of boxes. The eight blocks of code will fill up all eight rows of the grid.

Circulate while the students fill in their grids, to make sure that they are aligning the blocks of code and the rows of the grid.
As students complete their grids, they will see a (pixellated) shape of a living thing. Students will discover that sometimes they get the same shape as someone else. Once all students have filled in their grid, ask what shapes they made.
(The last sheet of the code worksheet informs the teacher of the shapes that the students should make with each code.)
Sometimes a student will make an error - this can also be used for discussion on what happens when there is an error in a DNA sequence - see Closure Discussion following.

Closure Discussion:
Just as the letters of the code in our activity could make many different living things, the DNA code in all living things can give rise to the variety of living things.
The code in our activity had just two letters and was only 70 units long. We were able to make several different shapes from it and you can imagine many more shapes that could be make with these letters and this grid. DNA has 4 letters and in people is 3 billion units long, so there are many, many more ways that the letters can be arranged, making many, many different kinds of instructions possible, so giving rise to a huge variety of living things.
If a student made an error in their code and did not get a recognizable picture, use this to discuss what happens with DNA: when DNA is copied, sometimes an error is made, and the wrong letter appears in the DNA sequence. When this happens the instructions are changed, and the living thing may not survive, or may have a disorder.

If students are keen and able, information on DNA code can become more detailed:
The four different units in DNA are called A, C, G and T (they may be familiar to some students). The units are joined together in a long string, for example AATTCGTCGTTAATCTGATC, and so on, 3 billion of them in people.
Each of us has a slightly different order of these four units, so our instructions are a little different, so we look a little different from each other: our hair colour, whether we are a boy or a girl etc. But, all of our instructions are similar enough that we are all people.
Other living things have the same 4 letters, but in another order, so the instructions are different enough to make a different living thing.
Our instructions are quite similar to apes, so we are fairly similar to the apes. Our instructions are very different from a tree, so we look quite different from a tree. However, we do have some internal chemistry in common with a tree, so some of our instructions are even the same as a tree!
Scientists study the order of the As, Cs, Gs and Ts in different living things to understand how they are related to each other and how living things evolved.

Attached documents
Notes

This is an attractive activity to, surprisingly, students grades 1 through 7. No modifications are needed for different grades, just how much time to spend on going over the instructions on how to do the sheet. Older students can get a couple of codes back to back.

Note that the image is a previous version of the activity (that had 1s and 2s instead of Ps and Ws). The attached file is the updated version. (Note to self: see SRP for DNA code puzzle file.)

Grades taught
Gr K
Gr 1
Gr 2
Gr 3
Gr 4
Gr 5
Gr 6
Gr 7

Foods Chemistry

Summary
Make/eat snack foods and discover the state changes and chemical reactions in them.
Curriculum connection (2005 science topic)
Physical Science: Properties of Matter (grade 2)
Physical Science: Chemistry (grade 7)
Procedure

To introduce molecules, optionally act out the states of matter with the students, so that they are familiar with what happens on the molecular level in a state of matter change. Show them each state in water as they move from one state to the next and back.

Make a snack that involves changing liquid water into a gas: popcorn. While it is heating up, act out what is happening to the water inside the kernal as the water evaporates (liquid to gas) - students can divide into groups and make skits about what is happening to the molecules.

Make a gas by a chemical reaction to make a soda drink.

Make ice cream and discover the state changes that makes it.

Using baking soda, predict how sour candies are, then taste them to check!

Also see the buttered popcorn lesson.

Grades taught
Gr K
Gr 1
Gr 2
Gr 3
Gr 5
Gr 6
Gr 7

Root shapes

Summary
Look at different plant roots to see how their shapes vary, and discuss how this might be adaptations for getting water in different ways.
Science topic (2005 curriculum connection)
Earth and Space Science: Air, Water and Soil (grade 2)
Life Science: Needs of Living Things (grade 1)
Life Science: Plant Growth and Changes (grade 3)
Materials
  • different plants/weeds, with roots intact, washed free of soil - or provide students with tools and water to dig up and wash roots themselves
Procedure

Lay out the plants for students to see.
Provide activities and discussion around root shapes and functions:
Sort the plants by root length.
Discuss how the longer roots might be able to get water from further down than the shorter roots. Discuss how the widely branched roots might be able to gather water from further sideways. Discuss how each kind of root anchors the plant in the soil.
Draw some differing root shapes.

Grades taught
Gr K
Gr 1
Gr 2

Plant features: drip tips, waxy coating, bendy stems

Summary
Drip water on leaves to see how leaves are waterproof and shaped to direct rain water off the leaf. Compare with other surfaces.
Science topic (2005 curriculum connection)
Earth and Space Science: Weather (grade 4)
Life Science: Needs of Living Things (grade 1)
Life Science: Plant Growth and Changes (grade 3)
Physical Science: Properties of Objects and Materials (grade K)
Materials
  • either leaves on plants outdoors
  • or leaves on a branch brought indoors and duct-taped to the edge of a tray in a natural position
  • dropper bottles filled with water, that can dispense a drop at a time e.g. empty food colouring bottle
  • for demonstration: clothing types that absorb water rapidly or make it bead up on their surface
  • modelling clay
Procedure

If possible, take students outside to a place with bushes. Alternatively, indoors, tape cut branches into trays so that they hang over the tray.
Give each student a dropper bottle filled with water, and a worksheet.
Ask them to drip individual drops on leaves and watch what happens to the drips:
First compare how quickly the water soaks into the leaf compared to their clothing made of different fabrics.
Then if the water runs off the leaf, draw the path of the water for different leaf shapes. Record on the worksheet.

Outside or indoors, give students modelling clay, to mimic heavy snow. They wrap the clay around stems to see if the stems bend or break.

Discussion of discoveries:
Usually dripped water stays as a drop, and flows off the leaf via the pointed drip tip (if the leaf has one), sometimes after it has fused with other drops. The drops do not soak into the leaf.
The drip tips divert water off the leaf, so that bacteria and fungus does not have a place to grow.
The waxy coating forms a physical barrier that resists penetration by virus particles, bacteria and fungi. It also prevents water loss from the leaf.
Evergreen plants have an especially waxy coating, to prevent water loss through the winter, when the ground is frozen and the plants are not able to access liquid water.
Our evergreen natives such as cedar, salal and oregon grape will bend when weight is added to their stems. They are able to carry snow without snapping. Other natives, such as salmonberry, snap with the weight, but they lose their leaves in the winter and so the snow will not build up on them so much.

Notes

Not sure that temperate rainforest leaves have technical drip tips. Most leaves in all biomes of the world have some kind of a point at the end which directs water off the leaf, but our temperate rainforest leaves don't have a particularly pointy or long tip (whereas tropical rainforest leaves do).

Cedar is a little confusing with the water drops, as they tend to go between the scales, looking like they have soaked in.
Maybe use only wider leaves?

Grades taught
Gr K
Gr 1
Gr 2
Gr 3
Gr 4